The Future of Life

Filename: the-future-of-life.pdf
ISBN: 9780375414565
Release Date: 2002-04-09
Number of pages: 256
Author: Edward O. Wilson
Publisher: Vintage

Download and read online The Future of Life in PDF and EPUB One of the world’s most important scientists, Edward O. Wilson is also an abundantly talented writer who has twice won the Pulitzer Prize. In this, his most personal and timely book to date, he assesses the precarious state of our environment, examining the mass extinctions occurring in our time and the natural treasures we are about to lose forever. Yet, rather than eschewing doomsday prophesies, he spells out a specific plan to save our world while there is still time. His vision is a hopeful one, as economically sound as it is environmentally necessary. Eloquent, practical and wise, this book should be read and studied by anyone concerned with the fate of the natural world.


The Future of Life Meta Evolution

Filename: the-future-of-life-meta-evolution.pdf
ISBN: 9781425726843
Release Date: 2006-10-01
Number of pages: 404
Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut

Download and read online The Future of Life Meta Evolution in PDF and EPUB The Future of Life: Meta-Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe, both organic and inorganic. These include all facets of human existence and civilisation- the sciences, technology, arts, humanities and religion. In essence, by applying quantum information, network and decision theory, it is demonstrated that an overarching evolutionary process shapes the spectrum of life and phenomena in the universe, as a generic paradigm beyond Darwin's original biology-based theory. The Theory of Evolution is undoubtedly the most powerful paradigm ever conceived by humans to explain their own existence. Since Darwin´s epoch-making treatise, Origin of Species', published in 1859, evolution has been centre-stage, universally recognised as the driving force in the emergence of modern humans from the genesis of life on this planet almost 4 billion years ago. However, despite its ubiquitous brilliance as the jewel in the crown of human intellectual achievement, the notion of evolution has never been developed to its full potential. It remains instead constrained within its biological cradle, often reduced in everyday connotation to its lowest common denominator of ´survival of the fittest´. The intention of this book to re-evaluate and expand the Darwinian model of evolution; to demonstrate that its current application is only the tip of the intellectual iceberg and that by combining its formidable biological principles with those of decision complexity, network, quantum and information theory, it emerges as an incalculably deeper and richer model than previously contemplated. It will be demonstrated that the evolutionary engine which drives biological development, also drives all other dynamic adaptive processes- the physical, social, cognitive, economic, political and technological and is in fact the major dynamic governing the Universe, past present and future. It is further proposed to demonstrate that recent developments in artificial intelligence and ubiquitous computing through the Internet, mark the next crucial stage in life's evolution, involving the inevitable symbiosis of vast computational intelligence with the human mind. The major hypothesis developed in this book, of a global all-encompassing Theory of Evolution, coupled with its potential for realising the emancipation of human intelligence and potential, provides a vastly more powerful paradigm for exploring the Future of Life than current scientific scenarios. The resulting Omega state of infinite knowledge and wisdom which is proposed, has been actively championed by a number of eminent 19th and 20th century philosophers such as Teillhard de Chardin, Henri Bergson, Schelling, Alfred Whitehead, Samuel Alexander and more recently by the leading physicist and futurist- Professor Frank Tipler. However to date no equivalent scientific framework for supporting such a hypothesis has been provided. In conclusion, The Future of Life: Meta-Evolution has been written not as an academic text but as primarily a non-technical review of the evidence to support such a hypothesis, in much the same vein as other recent publications in the popular science/philosophy genre. It is hoped that this approach will therefore provide a window into the wider evolutionary debate for the general reader interested in one of the most critical emerging paradigm shifts of the 21st century.


The Future of Life and the Future of our Civilization

Filename: the-future-of-life-and-the-future-of-our-civilization.pdf
ISBN: 9781402049682
Release Date: 2006-10-12
Number of pages: 495
Author: Vladimir Burdyuzha
Publisher: Springer Science & Business Media

Download and read online The Future of Life and the Future of our Civilization in PDF and EPUB This book covers the proceedings of "The Future of Life and the Future of our Civilization" symposium, held in Frankfurt, Germany in May 2005.


The Future of Life A Unified Theory of Evolution

Filename: the-future-of-life-a-unified-theory-of-evolution.pdf
ISBN:
Release Date: 2010-09-11
Number of pages:
Author: David Hunter Tow
Publisher: Future of Life Media

Download and read online The Future of Life A Unified Theory of Evolution in PDF and EPUB The Future of Life: A Unified Theory of Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe- both organic and inorganic. In essence by combining information, decision, network and quantum theory, it is demonstrated that an overarching evolutionry process shapes the spectrum of life and all phenomena in the universe, beyond Darwin's original biological theory.


The Future of Life on Earth

Filename: the-future-of-life-on-earth.pdf
ISBN: 9781406232622
Release Date: 2013-02-01
Number of pages: 48
Author: Michael Bright
Publisher: Raintree

Download and read online The Future of Life on Earth in PDF and EPUB Explains how many of the living things on Earth are still to be found and described, as well as things that affect biodiversity and what our world might look like in years to come. Looks at ways that human activity is affecting biodiversity and how that may play out in the future of life on Earth based on past instances of mass extinction, and also looks forward to the time when the Sun will no longer support life on the planet.


Conservation and the Future of Life

Filename: conservation-and-the-future-of-life.pdf
ISBN: OCLC:77607202
Release Date: 2002
Number of pages:
Author: Missouri Botanical Garden
Publisher:

Download and read online Conservation and the Future of Life in PDF and EPUB




Creation

Filename: creation.pdf
ISBN: 9780141970226
Release Date: 2013-04-04
Number of pages: 272
Author: Adam Rutherford
Publisher: Penguin UK

Download and read online Creation in PDF and EPUB 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG


The Future of Life

Filename: the-future-of-life.pdf
ISBN: 0971043930
Release Date: 2002-01-01
Number of pages: 24
Author: Edward O. Wilson
Publisher:

Download and read online The Future of Life in PDF and EPUB


The Future of LIfe

Filename: the-future-of-life.pdf
ISBN:
Release Date: 1933
Number of pages: 152
Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut

Download and read online The Future of LIfe in PDF and EPUB


The Second Law of Life

Filename: the-second-law-of-life.pdf
ISBN: 9780815519300
Release Date: 2007-01-22
Number of pages: 226
Author: John E.J. Schmitz
Publisher: Elsevier

Download and read online The Second Law of Life in PDF and EPUB In this compelling, and important book, John Schmitz brings order to the world of chaos that surrounds us. The Second Law of Life refers to the second law of thermodynamics, entropy, which is an omnipresent force that quietly and crucially determines every aspect of our society, culture and daily lives. Unless we come to understand entropy, future generations will face consequences of the unstoppable laws of physics. Entropy explains the amount of energy no longer capable of doing work; in other words, wasted energy or heat loss. Each moment of every day, we lose irreplaceable energy and ômodernö technology is not helping. In fact, it is accelerating the problem at a catastrophic rate. û And we will ultimately face a heat death crisis and utter destruction of the Earth. Even actions we take to improve the environment may actually do more damage than good. For example, recycling is considered environmentally, socially and politically correct. Under the influence of entropy, however, it is a prolific waster of energy; we must look at entire systems, not just parts. It is critical that we find ways to reduce energy loss. Seeing the problems with greater clarity will lead to solutions. This fascinating and accessible journey through the second law of thermodynamics is a step in the right direction.


Positive Mind In a Negative World

Filename: positive-mind-in-a-negative-world.pdf
ISBN: 9781450090117
Release Date: 2010-11-18
Number of pages: 346
Author: Erwin Pajares
Publisher: Xlibris Corporation

Download and read online Positive Mind In a Negative World in PDF and EPUB


The Dawn of Symbolic Life

Filename: the-dawn-of-symbolic-life.pdf
ISBN: 1439268339
Release Date: 2010-01-04
Number of pages: 140
Author: Jon Beach
Publisher: Jon Beach

Download and read online The Dawn of Symbolic Life in PDF and EPUB Approaching evolution from a different point of view, The Dawn of Symbolic Life examines how the rise of civilization and ongoing current technological progress can be seen as an extension of biological evolution. A fascinating blend of biology, philosophy, and economics, the book outlines a formidable and compelling set of ideas that places mankind at the center of an epic evolutionary event. An event that the author believes could lead to a transformation of the world as we know it. By stepping back and analyzing such contemporary issues as environmental sustainability, space exploration, the spread of information technology, and the role of religion in modern society from the long term perspective of the entire history of life, the author reaches some remarkable conclusions concerning the significance of recent events and what they portend for the future. In a profoundly optimistic assessment, the reader is methodically guided toward a fascinating vision of the future that is both inspiring and somewhat unsettling. The author, Jon Beach is both a researcher and published author in the field of evolutionary biology and an active entrepreneur in the world of business. From this combination of viewpoints comes a unique and surprising perspective on the human condition.


Biological Resource Centres Underpinning the Future of Life Sciences and Biotechnology

Filename: biological-resource-centres-underpinning-the-future-of-life-sciences-and-biotechnology.pdf
ISBN: 9789264193550
Release Date: 2001-05-22
Number of pages: 68
Author: OECD
Publisher: OECD Publishing

Download and read online Biological Resource Centres Underpinning the Future of Life Sciences and Biotechnology in PDF and EPUB Biotechnology and the genomics revolution are changing our world’s scientific-technological and socio-economic framework. A new type of raw material – one invisible to the naked eye – will become the essential ingredient of the life sciences and ...