Adam and the Genome

Filename: adam-and-the-genome.pdf
ISBN: 9781493406746
Release Date: 2017-01-31
Number of pages: 240
Author: Scot McKnight
Publisher: Brazos Press

Download and read online Adam and the Genome in PDF and EPUB Genomic science indicates that humans descend not from an individual pair but from a large population. What does this mean for the basic claim of many Christians: that humans descend from Adam and Eve? Leading evangelical geneticist Dennis Venema and popular New Testament scholar Scot McKnight combine their expertise to offer informed guidance and answers to questions pertaining to evolution, genomic science, and the historical Adam. Some of the questions they explore include: - Is there credible evidence for evolution? - Do we descend from a population or are we the offspring of Adam and Eve? - Does taking the Bible seriously mean rejecting recent genomic science? - How do Genesis's creation stories reflect their ancient Near Eastern context, and how did Judaism understand the Adam and Eve of Genesis? - Doesn't Paul's use of Adam in the New Testament prove that Adam was a historical individual? The authors address up-to-date genomics data with expert commentary from both genetic and theological perspectives, showing that genome research and Scripture are not irreconcilable. Foreword by Tremper Longman III and afterword by Daniel Harrell.


Adam and the Genome

Filename: adam-and-the-genome.pdf
ISBN: 158743394X
Release Date: 2017-01-31
Number of pages: 240
Author: Scot McKnight
Publisher: Brazos Press

Download and read online Adam and the Genome in PDF and EPUB Genomic science indicates that humans descend not from an individual pair but from a large population. What does this mean for the basic claim of many Christians: that humans descend from Adam and Eve? Leading evangelical geneticist Dennis Venema and popular New Testament scholar Scot McKnight combine their expertise to offer informed guidance and answers to questions pertaining to evolution, genomic science, and the historical Adam. Some of the questions they explore include: - Is there credible evidence for evolution? - Do we descend from a population or are we the offspring of Adam and Eve? - Does taking the Bible seriously mean rejecting recent genomic science? - How do Genesis's creation stories reflect their ancient Near Eastern context, and how did Judaism understand the Adam and Eve of Genesis? - Doesn't Paul's use of Adam in the New Testament prove that Adam was a historical individual? The authors address up-to-date genomics data with expert commentary from both genetic and theological perspectives, showing that genome research and Scripture are not irreconcilable. Foreword by Tremper Longman III and afterword by Daniel Harrell.


Adam Eve and the Genome

Filename: adam-eve-and-the-genome.pdf
ISBN: 1451418639
Release Date:
Number of pages: 200
Author: Susan Brooks Thistlethwaite
Publisher: Fortress Press

Download and read online Adam Eve and the Genome in PDF and EPUB Explores the ethical issues posed by genetic engineering.


A Brief History of Everyone Who Ever Lived

Filename: a-brief-history-of-everyone-who-ever-lived.pdf
ISBN: 9780297609391
Release Date: 2016-09-08
Number of pages: 432
Author: Adam Rutherford
Publisher: Hachette UK

Download and read online A Brief History of Everyone Who Ever Lived in PDF and EPUB This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.


The Lost World of Adam and Eve

Filename: the-lost-world-of-adam-and-eve.pdf
ISBN: 9780830824618
Release Date: 2015-03-27
Number of pages: 256
Author: John H. Walton
Publisher: InterVarsity Press

Download and read online The Lost World of Adam and Eve in PDF and EPUB The Lost World of Adam and Eve enters into the debate over the Bible and human origins. Adam and Eve emerge as archetypal but real individuals chosen for roles and functions. The details of the Genesis story take on sharper definition as they are backlit by ancient Near Eastern thinking, and invite our full engagement with the science.


The Genome

Filename: the-genome.pdf
ISBN: 9781497643949
Release Date: 2014-12-02
Number of pages: 496
Author: Sergei Lukyanenko
Publisher: Open Road Media

Download and read online The Genome in PDF and EPUB A science fiction thriller by the author of Night Watch, the hit novel that inspired two major motion pictures Five months after the horrific accident that left him near death and worried that he’d never fly again, master-pilot Alex Romanov lands a new job: captaining the sleek passenger vessel Mirror. Alex is a spesh—a human who has been genetically modified to perform particular tasks. As a captain and pilot, Alex has a genetic imperative to care for passengers and crew—no matter what the cost. His first mission aboard Mirror is to ferry two representatives of the alien race Zzygou on a tour of human worlds. His task will not be an easy one, for aboard the craft are several speshes who have reason to hate the Others. Dark pasts, deadly secrets, and a stolen gel-crystal worth more than Alex’s entire ship combine to challenge him at every turn. And as the tension escalates, it becomes apparent that greater forces are at work to bring the captain’s world crashing down.


The Evolution of Adam

Filename: the-evolution-of-adam.pdf
ISBN: 9781441236333
Release Date: 2012-01-01
Number of pages: 192
Author: Peter Enns
Publisher: Baker Books

Download and read online The Evolution of Adam in PDF and EPUB Can Christianity and evolution coexist? Traditional Christian teaching presents Jesus as reversing the effects of the Fall of Adam. However, an evolutionary view of beginnings doesn't allow for a historical Adam, making evolution seemingly incompatible with what Genesis and the apostle Paul say about him. For Christians who accept evolution and want to take the Bible seriously, this presents a faith-shaking tension. Peter Enns, an expert in biblical interpretation, offers a way forward by explaining how this tension is caused not by the discoveries of science but by false expectations about the biblical texts. Focusing on key biblical passages in the discussion, Enns demonstrates that the author of Genesis and the apostle Paul wrote to ask and answer ancient questions for ancient people; the fact that they both speak of Adam does not determine whether Christians can accept evolution. This thought-provoking book helps readers reconcile the teachings of the Bible with the widely held evolutionary view of beginnings and will appeal to anyone interested in the Christianity-evolution debate.


Genetics Genomics and Breeding of Grapes

Filename: genetics-genomics-and-breeding-of-grapes.pdf
ISBN: 9781439871997
Release Date: 2016-04-19
Number of pages: 396
Author: Anne-Francoise Adam-Blondon
Publisher: CRC Press

Download and read online Genetics Genomics and Breeding of Grapes in PDF and EPUB Grapevine is a highly valuable crop worldwide, both from a cultural as well as a commercial point of view. One of its major advantages is that it is well adapted to scarce water conditions. The main object of grapevine breeding is to develop varieties that are resistant to pathogens and at the same time well-adapted to a changing environment. Since the beginning of the 21st century, there has been a concerted effort by the international scientific community to develop genomic tools and resources for grapevine, culminating in its complete genome sequence. The book reviews these efforts and their usefulness for grapevine breeding and viticulture improvement.


Adam the Fall and Original Sin

Filename: adam-the-fall-and-original-sin.pdf
ISBN: 9781441246417
Release Date: 2014-10-28
Number of pages: 352
Author: Michael Reeves
Publisher: Baker Academic

Download and read online Adam the Fall and Original Sin in PDF and EPUB The Christian doctrines of original sin and the historical fall of Adam have been in retreat since the rise of modernity. Here leading scholars present a theological, biblical, and scientific case for the necessity of belief in original sin and the historicity of Adam and Eve in response to contemporary challenges. Representing various Christian traditions, the contributors shed light on recent debates as they present the traditional doctrine of original sin as orthodox, evangelical, and the most theologically mature and cogent synthesis of the biblical witness. This fresh look at a heated topic in evangelical circles will appeal to professors, students, and readers interested in the creation-evolution debate.


Adam s Curse

Filename: adam-s-curse.pdf
ISBN: 0552161934
Release Date: 2010-02-28
Number of pages: 384
Author: Bryan Sykes
Publisher: Corgi

Download and read online Adam s Curse in PDF and EPUB Genetically speaking, the only difference between men and women is that where women have two X chromosomes, men have one X and one Y. It is surprising that one chromosome difference out of our total of forty-six can have such an important consequence, but it does. Is this relatively small genetic variance really sufficient to explain the huge differences between the sexes, not just the physical but the psychological, social, even cultural? Drawing on his own work at the forefront of modern genetics and the exciting theories of evolutionary biology, Bryan Sykes explores the mysteries of the science of sex and gender, and takes a scientific look at what makes men tick. He addresses the most basic issues of why there are only two sexes in humans and, even, why there is sex at all. He also raises more far-reaching questions, such as: Is there a genetic cause for men's greed, aggression and promiscuity? Is there such a thing as the male homosexual gene? And what do genes tell us about the future for men? Sykes's conclusions will surprise some people and are bound to cause controversy. The all-important male Y chromosome is getting smaller and, as the generations pass, the female genome is taking over as it cannibalizes parts of the Y chromosome. Women are winning the evolutionary battle of the sexes. The shocking conclusion is that men, slowly but surely, are headed for extinction.


Creation

Filename: creation.pdf
ISBN: 9780141970226
Release Date: 2013-04-04
Number of pages: 272
Author: Adam Rutherford
Publisher: Penguin UK

Download and read online Creation in PDF and EPUB 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG


The Hum of Angels

Filename: the-hum-of-angels.pdf
ISBN: 9781601426338
Release Date: 2017-02-07
Number of pages: 224
Author: Scot McKnight
Publisher: WaterBrook

Download and read online The Hum of Angels in PDF and EPUB Would You Recognize an Angel if You Saw One? The majority of earth’s inhabitants believe in Angels. Yet so few of us can claim to have seen one. Why? Perhaps it’s because in order to encounter one, we first have to learn what to look for and how to look! We live in a world where the natural and supernatural overlap. Angels are constantly on mission from God and constantly at work in this world. From the Garden of Eden to the Book of Revelation, Scripture is filled with hundreds of references to these wondrous creatures. In this creative work, Scot McKnight explores what the Bible says – and doesn’t say – about these majestic beings. And that’s deeply important because angels are still on mission today. They express God’s love, confirm His presence, and even lead humans in redemptive worship. Don’t just believe in angels. Learn how to recognize these messengers of God that are all around us and know how God might be using them to affect our lives. Most People Believe in Angels. It’s What we Believe About them that Matters. Believing in angels is one thing. But how can we know what angels are really like – especially when our preconceived notions have been mostly shape by sensationalized misinterpretations of these wondrous beings? To help sort things out, Scot McKnight untangles fact from fiction on topics such as: * Do loved ones become angels when they die? * Can we hear from angels? * Is there a hierarchy of angels? * Do we have a specific guardian angel? * Should we be scared of angels? * Are cherubs and seraphs different creatures than angels? * Do angels have wings? * Are angels worship leaders? The Hum of Angels illuminates what the Bible says about these heavenly beings; and it helps you to understand the deepest truths about one of God’s most magnificent and yet misunderstood creations.


Evolution and the Fall

Filename: evolution-and-the-fall.pdf
ISBN: 9780802873798
Release Date: 2017
Number of pages: 256
Author: Cavanaugh & Smith
Publisher: Wm. B. Eerdmans Publishing

Download and read online Evolution and the Fall in PDF and EPUB What does it mean for the Christian doctrine of the Fall if there was no historical Adam? If humanity emerged from nonhuman primates--as genetic, biological, and archaeological evidence seems to suggest--then what are the implications for a Christian understanding of human origins, including the origin of sin? Evolution and the Fall gathers a multidisciplinary, ecumenical team of scholars to address these difficult questions and others like them from the perspectives of biology, theology, history, Scripture, philosophy, and politics CONTRIBUTORS: William T. Cavanaugh Celia Deane-Drummond Darrel R. Falk Joel B. Green Michael Gulker Peter Harrison J. Richard Middleton Aaron Riches James K. A. Smith Brent Waters Norman Wirzba


Advanced Analytics with Spark

Filename: advanced-analytics-with-spark.pdf
ISBN: 9781491972908
Release Date: 2017-06-12
Number of pages: 280
Author: Sandy Ryza
Publisher: "O'Reilly Media, Inc."

Download and read online Advanced Analytics with Spark in PDF and EPUB In the second edition of this practical book, four Cloudera data scientists present a set of self-contained patterns for performing large-scale data analysis with Spark. The authors bring Spark, statistical methods, and real-world data sets together to teach you how to approach analytics problems by example. Updated for Spark 2.1, this edition acts as an introduction to these techniques and other best practices in Spark programming. You’ll start with an introduction to Spark and its ecosystem, and then dive into patterns that apply common techniques—including classification, clustering, collaborative filtering, and anomaly detection—to fields such as genomics, security, and finance. If you have an entry-level understanding of machine learning and statistics, and you program in Java, Python, or Scala, you’ll find the book’s patterns useful for working on your own data applications. With this book, you will: Familiarize yourself with the Spark programming model Become comfortable within the Spark ecosystem Learn general approaches in data science Examine complete implementations that analyze large public data sets Discover which machine learning tools make sense for particular problems Acquire code that can be adapted to many uses


Doing Without Adam and Eve

Filename: doing-without-adam-and-eve.pdf
ISBN: 1451415435
Release Date: 2001-06-19
Number of pages: 248
Author: Patricia A. Williams
Publisher: Fortress Press

Download and read online Doing Without Adam and Eve in PDF and EPUB In this provocative new addition to the Theology and the Sciences series, Patricia Williams assays the original sin doctrine with a scientific lens and, based on sociobiology, offers an alternative Christian account of human nature's foibles and future. Focusing on the Genesis 2 and 3 account, Williams shows how its "historical" interpretation in early Christianity not only misread the text but derived an idea of being human profoundly at odds with experience and contemporary science. After gauging Christianity's several competing notions of human nature -- Protestant, Catholic, and Orthodox -- against contemporary biology, Williams turns to sociobiological accounts of the evolution of human dispositions toward reciprocity and limited cooperation as a source of human good and evil. From this vantage point she offers new interpretations of evil, sin, and the Christian doctrine of atonement. Williams's work, frank in its assessment of traditional misunderstandings, challenges theologians and all Christians to reassess the roots and branches of this linchpin doctrine.